ID: 1015434375_1015434381

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1015434375 1015434381
Species Human (GRCh38) Human (GRCh38)
Location 6:133168892-133168914 6:133168942-133168964
Sequence CCTCATCAGACTTCAGAAAGTAC AAATTGTTGTCATTAGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 156} {0: 1, 1: 0, 2: 1, 3: 41, 4: 563}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!