ID: 1015441960_1015441966

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1015441960 1015441966
Species Human (GRCh38) Human (GRCh38)
Location 6:133258850-133258872 6:133258902-133258924
Sequence CCCCTTCAATTTTACTGAAGAAT AACCCTAGGGTCTTTCTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 73, 4: 517} {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!