|
Left Crispr |
Right Crispr |
| Crispr ID |
1015443092 |
1015443096 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:133271134-133271156
|
6:133271175-133271197
|
| Sequence |
CCGTGAATCCTGGCTATGGGAGA |
ATGCTGATTCAGAGCGTACATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 129, 1: 151, 2: 122, 3: 124, 4: 261} |
{0: 3, 1: 72, 2: 96, 3: 98, 4: 154} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|