ID: 1015502614_1015502622

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1015502614 1015502622
Species Human (GRCh38) Human (GRCh38)
Location 6:133950160-133950182 6:133950204-133950226
Sequence CCAAGCCTGGGATGGATGACTCC CTAGGCCAGTTCTACATTTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 12, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!