ID: 1015503018_1015503033

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1015503018 1015503033
Species Human (GRCh38) Human (GRCh38)
Location 6:133952996-133953018 6:133953032-133953054
Sequence CCACCGAGCCCAGCGGGTGGGCA TTGGGGACCAGGAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 173} {0: 1, 1: 0, 2: 9, 3: 94, 4: 808}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!