ID: 1015503784_1015503789

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1015503784 1015503789
Species Human (GRCh38) Human (GRCh38)
Location 6:133960623-133960645 6:133960675-133960697
Sequence CCTGAAACAATATTCTGAATTTG CTTTGGGTATAGAGGAAAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 28, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!