ID: 1015504222_1015504224

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1015504222 1015504224
Species Human (GRCh38) Human (GRCh38)
Location 6:133964830-133964852 6:133964848-133964870
Sequence CCTTAAACAGGTTGTCTATGCTA TGCTAGAGCATTTTATATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!