ID: 1015506777_1015506780

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1015506777 1015506780
Species Human (GRCh38) Human (GRCh38)
Location 6:133996719-133996741 6:133996742-133996764
Sequence CCTTCCTCATTCTTCAAGTTCAC CTCAGCTTCTGTGCACAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 359} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!