ID: 1015539183_1015539190 |
View in Genome Browser |
Spacer: 5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1015539183 | 1015539190 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:134297328-134297350 | 6:134297356-134297378 |
| Sequence | CCTGCTAGGCCCGCTGCAGGGCG | CAGCTCAGACAGCTTGGCGTTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 8, 2: 13, 3: 25, 4: 131} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||