ID: 1015592348_1015592368

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1015592348 1015592368
Species Human (GRCh38) Human (GRCh38)
Location 6:134834037-134834059 6:134834073-134834095
Sequence CCTCCTCAAGTCCACAGAGAGAA GTGGGTTAGGGGAGGGAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 18, 3: 320, 4: 3598}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!