ID: 1015598163_1015598166

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1015598163 1015598166
Species Human (GRCh38) Human (GRCh38)
Location 6:134886297-134886319 6:134886316-134886338
Sequence CCTGGAAAGTATTTAATATTTGG TTGGTGGATAAATAAATCAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 74, 4: 669}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!