ID: 1015613179_1015613183

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1015613179 1015613183
Species Human (GRCh38) Human (GRCh38)
Location 6:135047946-135047968 6:135047980-135048002
Sequence CCTAAGTCACTACAAAATGTCTT CCCTGAATAAGGAGCTATAAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 239} {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!