ID: 1015629650_1015629652

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1015629650 1015629652
Species Human (GRCh38) Human (GRCh38)
Location 6:135219169-135219191 6:135219208-135219230
Sequence CCTACTTTTGTTTTCTCTCTTAT CAGTTACACTTTAAAGAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 124, 4: 1423} {0: 1, 1: 0, 2: 2, 3: 60, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!