ID: 1015636327_1015636329

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1015636327 1015636329
Species Human (GRCh38) Human (GRCh38)
Location 6:135278615-135278637 6:135278644-135278666
Sequence CCTAAATTATAAAAATATATTTA TAGTCCTTAATTCCAGCTACTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 38, 3: 384, 4: 2918} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!