|
Left Crispr |
Right Crispr |
| Crispr ID |
1015643321 |
1015643322 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:135362099-135362121
|
6:135362138-135362160
|
| Sequence |
CCATGGTGTGTGTGTGTAGGTGT |
ATATATGTATAAAGAAAATGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 9, 2: 378, 3: 1697, 4: 6613} |
{0: 1, 1: 16, 2: 413, 3: 3472, 4: 7823} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|