ID: 1015685252_1015685256

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1015685252 1015685256
Species Human (GRCh38) Human (GRCh38)
Location 6:135851695-135851717 6:135851730-135851752
Sequence CCAGTCAGTTGGTCTGGGCACTG CTCTGTCCCAGCACTTGTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 138} {0: 1, 1: 0, 2: 2, 3: 24, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!