ID: 1015735922_1015735928

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1015735922 1015735928
Species Human (GRCh38) Human (GRCh38)
Location 6:136400080-136400102 6:136400104-136400126
Sequence CCCTGCCCCTCCTACAAAAAAGT TTTTTTTCTTTTTTAAAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 360} {0: 3, 1: 92, 2: 919, 3: 8106, 4: 49114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!