ID: 1015798817_1015798818

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1015798817 1015798818
Species Human (GRCh38) Human (GRCh38)
Location 6:137040404-137040426 6:137040420-137040442
Sequence CCAGATTTTGGTTTCTAAACACC AAACACCTTTCTCCAATAGAAGG
Strand - +
Off-target summary {0: 2, 1: 18, 2: 102, 3: 271, 4: 551} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!