ID: 1015813780_1015813783

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1015813780 1015813783
Species Human (GRCh38) Human (GRCh38)
Location 6:137186773-137186795 6:137186825-137186847
Sequence CCTTCTGGGGCGACTCCTTTGAC ATTACCTCAACATTTTATTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 74} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!