ID: 1015831324_1015831327

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1015831324 1015831327
Species Human (GRCh38) Human (GRCh38)
Location 6:137372208-137372230 6:137372239-137372261
Sequence CCAAACCATGGAAAAAGCAACCT ATGCCCATCTAGAATACTGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 30, 4: 218} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!