ID: 1015843136_1015843147

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1015843136 1015843147
Species Human (GRCh38) Human (GRCh38)
Location 6:137493978-137494000 6:137494024-137494046
Sequence CCGCGGCCTTGGCGCCAGCCCGC CTGCATCATATCGCCCTGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 260} {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!