ID: 1015910166_1015910179

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1015910166 1015910179
Species Human (GRCh38) Human (GRCh38)
Location 6:138161830-138161852 6:138161862-138161884
Sequence CCGGCCCCAGCCCGCAGCCGCCG GCGCACCTGACCCAGGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 117, 4: 1017} {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!