ID: 1015910169_1015910179

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1015910169 1015910179
Species Human (GRCh38) Human (GRCh38)
Location 6:138161836-138161858 6:138161862-138161884
Sequence CCAGCCCGCAGCCGCCGCCGAGC GCGCACCTGACCCAGGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 60, 4: 413} {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!