ID: 1015926899_1015926900

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1015926899 1015926900
Species Human (GRCh38) Human (GRCh38)
Location 6:138319835-138319857 6:138319858-138319880
Sequence CCTGTGAGCTGGTGGTGGAGCAC ATTCAAAGCTTTCTACATTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 152} {0: 1, 1: 0, 2: 4, 3: 32, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!