ID: 1015928742_1015928747

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1015928742 1015928747
Species Human (GRCh38) Human (GRCh38)
Location 6:138335309-138335331 6:138335332-138335354
Sequence CCGATTTCCCTCCAAAGTCAGAG GACTGCCTGAACCTAAGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 229} {0: 1, 1: 0, 2: 2, 3: 9, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!