ID: 1015936135_1015936152

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1015936135 1015936152
Species Human (GRCh38) Human (GRCh38)
Location 6:138407490-138407512 6:138407540-138407562
Sequence CCCCAAGGCTTCAAGTGGCCCTG CTGCAGCTCTCACAGTTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 18, 4: 241} {0: 1, 1: 0, 2: 0, 3: 16, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!