ID: 1015983573_1015983577

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1015983573 1015983577
Species Human (GRCh38) Human (GRCh38)
Location 6:138863555-138863577 6:138863584-138863606
Sequence CCTAGCAGAGCACAGCAGGGTAT TGTTGCTGGTAATAGGGAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 193} {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!