ID: 1015985061_1015985065

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1015985061 1015985065
Species Human (GRCh38) Human (GRCh38)
Location 6:138876207-138876229 6:138876257-138876279
Sequence CCTGGCTCCCAAGGAAGAGGGAG ATGTAGTTCAAAAGAAGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 389} {0: 1, 1: 0, 2: 4, 3: 18, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!