ID: 1015985347_1015985350

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1015985347 1015985350
Species Human (GRCh38) Human (GRCh38)
Location 6:138879053-138879075 6:138879092-138879114
Sequence CCTCCTGCCTGCTGCTGAAACAC ACCTCCACTTCCAACTCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 314} {0: 1, 1: 0, 2: 3, 3: 23, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!