ID: 1016019405_1016019411

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1016019405 1016019411
Species Human (GRCh38) Human (GRCh38)
Location 6:139220009-139220031 6:139220038-139220060
Sequence CCCCCTCAAATTCATATGTTGAA ACTCTCAAACTGATGGTATTAGG
Strand - +
Off-target summary {0: 28, 1: 281, 2: 1011, 3: 2173, 4: 3280} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!