ID: 1016066959_1016066963

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1016066959 1016066963
Species Human (GRCh38) Human (GRCh38)
Location 6:139693796-139693818 6:139693829-139693851
Sequence CCCCACTACTTCAGGTGAAAGTG TTGAATTACTTAGCTAATTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 151} {0: 1, 1: 0, 2: 0, 3: 10, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!