ID: 1016083342_1016083351

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1016083342 1016083351
Species Human (GRCh38) Human (GRCh38)
Location 6:139882050-139882072 6:139882100-139882122
Sequence CCTGATCTGGTCAACATAGGCAC GCCTCAGCTGCAGCAGCACCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 96, 4: 1005}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!