ID: 1016153856_1016153868

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1016153856 1016153868
Species Human (GRCh38) Human (GRCh38)
Location 6:140780103-140780125 6:140780123-140780145
Sequence CCCCATTCCCCATCCCCTGTCAG CAGCCACAGTATGGTGCAAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!