ID: 1016154183_1016154188

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1016154183 1016154188
Species Human (GRCh38) Human (GRCh38)
Location 6:140783227-140783249 6:140783278-140783300
Sequence CCTATGCTGACCTGATAAACAAA GAGTGTAACAAGAGGGAAGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!