ID: 1016209431_1016209441

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1016209431 1016209441
Species Human (GRCh38) Human (GRCh38)
Location 6:141510394-141510416 6:141510442-141510464
Sequence CCCTCCTGCTTCAGCTTCTCCAG ATGTGCAGCTCCATGGGAATAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 11, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!