ID: 1016239158_1016239161

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1016239158 1016239161
Species Human (GRCh38) Human (GRCh38)
Location 6:141908313-141908335 6:141908360-141908382
Sequence CCAGAGTAGCAGCTGAAAGGCAG TTTTAGGTGCATGCAAACTAAGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 71, 3: 122, 4: 327} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!