ID: 1016241714_1016241718

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1016241714 1016241718
Species Human (GRCh38) Human (GRCh38)
Location 6:141939124-141939146 6:141939171-141939193
Sequence CCATCAACTATGTAAAATTACAG CCAGGAAATAAGTAAAAAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 26, 4: 385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!