ID: 1016263770_1016263771 |
View in Genome Browser |
Spacer: -7 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1016263770 | 1016263771 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 6:142207429-142207451 | 6:142207445-142207467 |
Sequence | CCAAATCAGAATGGCTGTTCAGC | GTTCAGCAGTACCATGCTGTAGG |
Strand | - | + |
Off-target summary | No data | {0: 2, 1: 11, 2: 31, 3: 65, 4: 168} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |