ID: 1016275655_1016275666

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1016275655 1016275666
Species Human (GRCh38) Human (GRCh38)
Location 6:142349384-142349406 6:142349417-142349439
Sequence CCCCCATGTAGCTGGAATGCCCC TTAGACTGGCACAAGGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 108} {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!