ID: 1016322660_1016322669

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1016322660 1016322669
Species Human (GRCh38) Human (GRCh38)
Location 6:142864041-142864063 6:142864074-142864096
Sequence CCTTTGCCCCTACCATTGGAAAG AAGCAGCCAAGCCAGCAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!