ID: 1016324121_1016324134

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1016324121 1016324134
Species Human (GRCh38) Human (GRCh38)
Location 6:142880296-142880318 6:142880346-142880368
Sequence CCAACAACCCCATAACTTGCACC AAAAATTGACTCCAATGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125} {0: 1, 1: 0, 2: 4, 3: 31, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!