ID: 1016362852_1016362855

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1016362852 1016362855
Species Human (GRCh38) Human (GRCh38)
Location 6:143286775-143286797 6:143286789-143286811
Sequence CCTCAGGGGCTGACCAGGCTGCT CAGGCTGCTGGCTGTTTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 310} {0: 1, 1: 0, 2: 1, 3: 20, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!