ID: 1016416866_1016416871

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1016416866 1016416871
Species Human (GRCh38) Human (GRCh38)
Location 6:143842903-143842925 6:143842924-143842946
Sequence CCTCCGTTGCTACGGCAACCGAC ACTCCGCCCCCACCCGGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 33} {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!