ID: 1016423299_1016423302 |
View in Genome Browser |
Spacer: -5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1016423299 | 1016423302 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:143907926-143907948 | 6:143907944-143907966 |
| Sequence | CCTTAATCCATCTTGAGTTGATT | TGATTTTTGCAGATGGTGTAAGG |
| Strand | - | + |
| Off-target summary | {0: 313, 1: 620, 2: 553, 3: 434, 4: 573} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||