ID: 1016435582_1016435586

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1016435582 1016435586
Species Human (GRCh38) Human (GRCh38)
Location 6:144034143-144034165 6:144034158-144034180
Sequence CCTGTGTTTACATGTAAAACCAC AAAACCACGTTGTTGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 175} {0: 1, 1: 0, 2: 3, 3: 17, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!