ID: 1016450676_1016450682 |
View in Genome Browser |
Spacer: 9 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1016450676 | 1016450682 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 6:144179268-144179290 | 6:144179300-144179322 |
| Sequence | CCTCGCACAACGTGTGGGAATTA | CATTCAAGATGAGATTTGGGTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 104, 1: 7793, 2: 11440, 3: 10277, 4: 8638} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||