ID: 1016473674_1016473675

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1016473674 1016473675
Species Human (GRCh38) Human (GRCh38)
Location 6:144402670-144402692 6:144402693-144402715
Sequence CCAGTATGAAGAGGGAGGAAGTC ACGAATTCCTGAGTTTTTATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!