ID: 1016542035_1016542039

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1016542035 1016542039
Species Human (GRCh38) Human (GRCh38)
Location 6:145177491-145177513 6:145177540-145177562
Sequence CCACATATTCTCACTTATTTATG TTATGGATATAGAGAGCAGAAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 96, 3: 1238, 4: 12390} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!