ID: 1016562112_1016562119

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1016562112 1016562119
Species Human (GRCh38) Human (GRCh38)
Location 6:145408283-145408305 6:145408326-145408348
Sequence CCAGTAACAGCTGTACTACCCAG GATTTGCATTCAGCCATTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!