ID: 1016647574_1016647577

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1016647574 1016647577
Species Human (GRCh38) Human (GRCh38)
Location 6:146427504-146427526 6:146427521-146427543
Sequence CCCAATTTGTTCAAATGTCTGCT TCTGCTACTGAACCTGGCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 23, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!